139528-83-9 Usage
Description
D(GGTGGCGACGACTCCTGGAGCCCG) is a synthetic DNA strand composed of a specific sequence of nucleotides containing the bases G, C, A, and T. The order of these bases in the sequence encodes genetic information, making it a valuable tool for various scientific and medical purposes.
Uses
Used in Biotechnology and Genetic Research:
D(GGTGGCGACGACTCCTGGAGCCCG) is used as a research tool for studying biological processes and developing new technologies in the field of biotechnology and genetics. Its precise composition allows for targeted experiments and the exploration of genetic mechanisms.
Used in Diagnostic Tests:
In the medical industry, D(GGTGGCGACGACTCCTGGAGCCCG) is used as a component in diagnostic tests to detect specific genetic markers or abnormalities. Its unique sequence can be designed to bind to complementary DNA or RNA sequences, enabling accurate identification and analysis of genetic material.
Used in Therapeutic Applications:
D(GGTGGCGACGACTCCTGGAGCCCG) has potential therapeutic applications, as it can be engineered to target specific genes or regulatory elements within the genome. This allows for the development of gene therapies or other treatments that can modulate gene expression or correct genetic defects.
Used in Drug Development:
In the pharmaceutical industry, D(GGTGGCGACGACTCCTGGAGCCCG) can be utilized in drug development to study the interactions between drugs and genetic material. This can help in designing drugs that are more effective and have fewer side effects by targeting specific genetic pathways or mechanisms.
Check Digit Verification of cas no
The CAS Registry Mumber 139528-83-9 includes 9 digits separated into 3 groups by hyphens. The first part of the number,starting from the left, has 6 digits, 1,3,9,5,2 and 8 respectively; the second part has 2 digits, 8 and 3 respectively.
Calculate Digit Verification of CAS Registry Number 139528-83:
(8*1)+(7*3)+(6*9)+(5*5)+(4*2)+(3*8)+(2*8)+(1*3)=159
159 % 10 = 9
So 139528-83-9 is a valid CAS Registry Number.