81144-43-6

Basic information

• Product Name: 5'-O-(4,4'-DIMETHOXYTRITYL)-2'-*DEOXYGUA NOSINE
• Synonyms: 5'-O-(4,4'-Dimethoxytrityl)-2'-deoxyguanosine;5'-O-(Dimethoxytrityl)-2'-deoxyguanosine
• CAS NO: 81144-43-6
• Molecular Formula: C₃₁H₃₁N₅O₆
• Molecular Weight: 569.615
• Mol File: 81144-43-6.mol
• Article Data: 11

Chemical Properties

• Appearance: /
• Storage Temp.: Store dry at 2-8°C
• CAS DataBase Reference: 5'-O-(4,4'-DIMETHOXYTRITYL)-2'-*DEOXYGUA NOSINE(CAS DataBase Reference)
• NIST Chemistry Reference: 5'-O-(4,4'-DIMETHOXYTRITYL)-2'-*DEOXYGUA NOSINE(81144-43-6)
• EPA Substance Registry System: 5'-O-(4,4'-DIMETHOXYTRITYL)-2'-*DEOXYGUA NOSINE(81144-43-6)

Safety Data

• Hazard Codes: T
• Statements: 23/24/25-36/37/38
• Safety Statements: 22-26-36/37/39-45
• Hazardous Substances Data: 81144-43-6(Hazardous Substances Data)

Usage

Description

5'-O-(4,4'-DIMETHOXYTRITYL)-2'-DEOXYGUA NOSINE is a chemical compound derived from the nucleoside guanosine, which is a fundamental building block of DNA. 5'-O-(4,4'-DIMETHOXYTRITYL)-2'-DEOXYGUA NOSINE features a 5'-O-(4,4'-dimethoxytrityl) protecting group, which is widely utilized in the solid-phase synthesis of DNA. Its unique chemical structure and properties render it a valuable tool for DNA and RNA research, manipulation, and the development of therapeutic drugs and diagnostic tools.

Uses

Used in Molecular Biology and Biochemistry:
5'-O-(4,4'-DIMETHOXYTRITYL)-2'-DEOXYGUA NOSINE is used as a protecting group in the solid-phase synthesis of DNA for the purpose of facilitating the process and ensuring accurate DNA sequence assembly.
Used in DNA Sequence Manipulation:
5'-O-(4,4'-DIMETHOXYTRITYL)-2'-DEOXYGUA NOSINE is used as a modifying agent for DNA sequences, enabling researchers to make specific changes and study the effects on genetic function and expression.
Used in Drug Development:
5'-O-(4,4'-DIMETHOXYTRITYL)-2'-DEOXYGUA NOSINE is used as a key component in the development of therapeutic drugs, particularly those targeting genetic disorders or diseases influenced by DNA and RNA interactions.
Used in Diagnostic Tool Development:
5'-O-(4,4'-DIMETHOXYTRITYL)-2'-DEOXYGUA NOSINE is utilized in the creation of diagnostic tools that detect and analyze DNA and RNA sequences, contributing to early disease identification and personalized medicine approaches.
Used in Research:
5'-O-(4,4'-DIMETHOXYTRITYL)-2'-DEOXYGUA NOSINE is employed as a research tool to study the structure, function, and interactions of DNA and RNA, furthering our understanding of genetic information and its role in various biological processes.

Upstream product

• 68892-41-1 5'-O-dimethoxytrityl-N-isobutyryldeoxyguanosine 
• 87036-65-5 Diphenyl-carbamic acid 9-{(2R,4S,5R)-5-[bis-(4-methoxy-phenyl)-phenyl-methoxymethyl]-4-hydroxy-tetrahydro-furan-2-yl}-2-propionylamino-9H-purin-6-yl ester 
• 91592-76-6 5'-O-(4,4'-dimethoxytrityl)-2-N-(diphenylacetyl)-2'-deoxyguanosine 
• 109464-23-5 N-(9-{(2R,4S,5R)-5-[Bis-(4-methoxy-phenyl)-phenyl-methoxymethyl]-4-hydroxy-tetrahydro-furan-2-yl}-6-oxo-6,9-dihydro-1H-purin-2-yl)-benzamide 
• 187674-24-4 (9-{(2R,4S,5R)-5-[Bis-(4-methoxy-phenyl)-phenyl-methoxymethyl]-4-hydroxy-tetrahydro-furan-2-yl}-6-oxo-6,9-dihydro-1H-purin-2-yl)-carbamic acid 2-(5-dimethylamino-naphthalene-1-sulfonyl)-ethyl ester 
• 199800-62-9 2'-deoxy-5'-O-(4,4'-dimethoxytrityl)-O⁶-<2-(phenylsulfonyl)ethyl>-N²-phthaloylguanosine 
• 226894-56-0 (2R,3S,5R)-5-{2-Amino-6-[2-(4-nitro-phenyl)-ethoxy]-purin-9-yl}-2-[bis-(4-methoxy-phenyl)-phenyl-methoxymethyl]-tetrahydro-furan-3-ol 
• 40615-36-9 4,4'-dimethoxytrityl chloride 
• 961-07-9 2'-Deoxyguanosine 
• 329781-64-8 2-azidomethyl-N-(9-{5-[bis-(4-methoxy-phenyl)-phenyl-methoxymethyl]-4-hydroxy-tetrahydro-furan-2-yl}-6-oxo-6,9-dihydro-1H-purin-2-yl)-benzamide 
• 129184-64-1 3',5'-bis-O-trimethylsilyl-2'-deoxyguanosine 
• 329781-62-6 2-azidomethyl-N-[9-(4-hydroxy-5-hydroxymethyl-tetrahydro-furan-2-yl)-6-oxo-6,9-dihydro-1H-purin-2-yl]-benzamide 
• 86137-72-6 2'-deoxy-O⁶-<2-(4-nitrophenyl)ethyl>guanosine 
• 108310-92-5 2-amino-6-(2-(p-nitrophenyl)ethyloxy)-9-[2'-deoxy-β-D-erythropentofuranosyl]purine diacetate 

Downstream Products

• 142738-43-0 3'-O-acetyl-5'-O-(4,4'-dimethoxytrityl)-2'-deoxyguanosine 
• 134817-01-9 Diisopropyl-phosphoramidous acid (2R,3S,5R)-5-(2-amino-6-oxo-1,6-dihydro-purin-9-yl)-2-[bis-(4-methoxy-phenyl)-phenyl-methoxymethyl]-tetrahydro-furan-3-yl ester methyl ester 
• 161786-58-9 DMT-deoxy-2-aminoadenosine 
• 961-07-9 2'-Deoxyguanosine 
• 109205-69-8 N₂-Fmoc-5'-O-DMT-deoxyguanosine 
• 140613-56-5 (2R,3S,5R)-5-(2-amino-6-oxo-1,6-dihydro-9H-purin-9-yl)-2-((bis(4-methoxyphenyl)(phenyl)methoxy)methyl)tetrahydrofuran-3-yl (2-cyanoethyl) diisopropylphosphoramidite 
• 905920-52-7 5'-O-(4,4'-dimethoxytrityl)-N²-2-nitrobenzen-1-yl-2'-deoxyguanosine 
• 110522-81-1 5’-O-dimethoxytrityl-N²-phenoxyacetyl-2’-deoxyguanosine 
• 118533-24-7 Succinic acid mono-{(2R,3S,5R)-2-[bis-(4-methoxy-phenyl)-phenyl-methoxymethyl]-5-[6-oxo-2-(2-phenoxy-acetylamino)-1,6-dihydro-purin-9-yl]-tetrahydro-furan-3-yl} ester 
• 156549-48-3 5'-O-dimethoxytrityl-N²,N⁶-bis(phenoxyacetyl)-2,6-diaminopurine 2'-deoxyriboside 

Relevant articles and documents

Polymerizable Compound, Compound, and Method for Producing Boranophosphate Oligomer

Provided a polymerizable compound represented by the following Formula A-1 or Formula A-2: In Formula A-1 or Formula A-2, R1 represents an electron-donating group; n represents an integer from 1 to 5; R2 represents a hydrogen atom, a halogen atom, or —ORO, wherein RO represents a hydrogen atom, an alkyl group, or a protecting group of a hydroxy group; R3 represents a hydrogen atom or a protecting group of a hydroxy group; and X represents a structure represented by any one of Formula B-1 to Formula B-5.

Nucleotides: Part LXI: Phthaloyl strategy: A new concept of oligonucleotide synthesis

A new alternative strategy of oligonucleotide synthesis was developed by use of the phthaloyl protecting group for the exocyclic amino functions of the nucleobases (see 9-12). This approach combines the advantages of cheap and easily accessible monomeric building blocks (see 17- 20), standard machine-aided oligonucleotide synthesis, and a fast deprotection protocol which is orthogonal to the cleavage procedure from the solid support. The crude oligonucleotides show high purity and require, in general, no further chromatographic purification.

Facile synthesis of oligodeoxyribonucleotides via the phosphoramidite method without nucleoside base protection

A facile synthesis of oligodeoxyribonucleotides via the phosphoramidite approach without base protection of the building blocks has been developed; it relies on the use of imidazolium triflate as a promoter for the condensation of a nucleoside phosphoramidite and a nucleoside. In the solution phase, the condensation is accomplished in a highly O-selective manner by using equimolar amounts of an N-free nucleoside phosphoramidite and an N-unblocked nucleoside to give, after oxidation with bis(trimethylsilyl)peroxide or with tert-butyl hydroperoxide, a dinucleoside phosphate in > 95% yield. In the solid-phase synthesis, which requires an excess amount of the phosphoramidite for the condensation, deoxyadenosine and deoxycytidine undergo N-phosphitylation to some extent. The undesired product, however, can be converted to the N-free derivative by brief treatment with benzimidazolium triflate in methanol. Thus the overall process allows the chemoselective formation of internucleotide linkage. The oligomers prepared by this N-unprotected solid-phase approach include (5')GTCACGACGTTGTAAAACGAC(3') (21mer), (5')CAGGAAACAG-CTATGACCATG(3') (21mer), (5')CAAGTTGATGAACAATACTTCATACCTAAACT(3') (32mer), and (5')TATGGGCCTTTGATAGGATGCTCACCGAGCAAAACCAAGAACAA-CCAGGAGATTTATT(3') (60mer), which are provided in excellent quality. PCR amplification of DNAs using the crude 21mers as primers is also demonstrated.